Content-Type: text/html; charset=utf-8 Pragma: no-cache Cache-Control: no-cache Zebrafish RP Knockdown Database

Zebrafish RP Knockdown Database

[TOP] | [Gene List]| [Photo Search]

cDNA sequence

Target gene MO concentration MO sequence Observation time female male last update
rps24 0.5μg/μL 25.5hpf AB-VIII-2-1 AB-V-6-1 2007-06-18 12:21:33
rps3 0.5μg/μL CTTCTTCGAGATTTGCACCGCCATC 26.5hpf AB-IX-5-1 AB-VI-4 2006-09-06 10:39:06
rps3a 0.5μg/μL TTTGCCGACTGCCATGTGAACAC 25hpf AB-XI-5-4 AB-I-6 2006-09-06 10:45:03
rps4 0.5μg/μL TGCTTCTTCGGTCCTCGGGCCATGT 24.5hpf AB-I-6 AB-I-6 2006-09-06 10:45:47
rps4-mis 0.5μg/μL TGgTTCTTgGGTgCTCcGGtCATGT 25hpf AB-I-6 AB-I-6 2006-09-06 11:00:54
rps8 0.5μg/μL TATCCCTTGAGATACCCATTCTC 25hpf AB-IX-5-2 AB-XI-5-3 2006-09-06 10:46:15
rps15 0.1μg/μL CTTCTTCTGCTCAGTGTCCGCCATC 29hpf AB-XI-5-3 AB-X-5-1 2006-09-06 10:58:54
rps15 0.5μg/μL CTTCTTCTGCTCAGTGTCCGCCATC 28hpf AB-XI-5-3 AB-X-5-1 2006-09-06 10:46:42
rps15a 0.1μg/μL CGCACCATGATGCCAGTTCTGCAAT 27hpf AB-IX-5-2 AB-XI-5-1 2006-09-11 13:08:04
rps15a 0.5μg/μL CGCACCATGATGCCAGTTCTGCAAT 26hpf AB-IX-5-2 AB-XI-5-1 2006-09-11 13:08:57
rps19 0.5μg/μL CACTGTTACACCACCTGGCATCTTG 25.5hpf AB-IX-5-2 AB-XI-5-2 2006-09-06 10:47:12
rps19-mis 0.5μg/μL CACTcTTAgACgACCTGcCATgTTG 24.5hpf AB-IX-5-2 AB-XI-5-2 2006-09-06 10:36:38
rps29 0.5μg/μL TCCAGTAGAGCTGCTGATGGCCCAT 24hpf AB-XI-5-4 AB-X-5-2 2006-09-06 10:57:32
rps29 2.5μg/μL TCCAGTAGAGCTGCTGATGGCCCAT 25hpf AB-XI-5-1 AB-X-5-1 2006-09-06 10:48:16
rps29 5μg/μL TCCAGTAGAGCTGCTGATGGCCCAT 26hpf AB-IX-5-2 AB-XI-5-3 2006-09-06 10:47:39
rpl5(MO116) 0.5μg/μL GACTTTTCAGTCTCCTAAGCCGGAG 25.5hpf AB-XI-5 AB-IX-5-1 2006-09-06 10:56:44
rpl5(MO116) 5μg/μL GACTTTTCAGTCTCCTAAGCCGGAG 25hpf AB-XI-5-1 AB-X-5-1 2006-09-06 10:52:54
rpl5(MO117) 0.5μg/μL ACCCATTTTGTGATCGTTTGTTCTC 25hpf AB-IX-5-2 AB-XI-5-3 2006-09-06 10:54:49
rpl5(MO117) 5μg/μL ACCCATTTTGTGATCGTTTGTTCTC 24hpf AB-IX-5-2 AB-XI-5-3 2006-09-06 10:53:47
rpl5(MO116&117) 0.5μg/μL 26hpf AB-VI-4 AB-VI-4 2006-09-06 10:55:50
rpl5(MO116&117) 5μg/μL 25hpf AB-VI-4-1 AB-IX-5-1 2006-09-06 10:52:08
rpl6 0.5μg/μL CTTCTTCTTATCGCCCTCAGCCATC 25hpf AB-XI-5 AB-XI-5-2 2006-09-06 10:42:12
rpl11 0.5μg/μL CTTCTTCTCGCTCTGGTCCGCCATG 27hpf AB-3-1 AB-X-5-2 2006-09-06 10:51:19
rpl24 0.5μg/μL ACTGCACAGCTCGACCTTCATGGCG 25.5hpf AB-I-6 AB-IX-5-1 2006-09-06 10:58:11
rpl24 5μg/μL ACTGCACAGCTCGACCTTCATGGCG 25.5hpf AB-IX-5-2 AB-X-5-1 2006-09-06 10:42:35
rpl24-mis 0.5μg/μL ACTcCAgAGCTCcACCTTgATcGCG 25hpf AB-I-6 AB-IX-5-1 2006-09-06 16:19:52
rpl24-mis 5μg/μL ACTcCAgAGCTCcACCTTgATcGCG 26.5hpf AB-IX-5-2 AB-X-5-1 2006-09-06 15:38:26
rpl28 5μg/μL CATTGCAGGTGAGGCGATGCCATGA 23.5hpf AB-IX-5-3 AB-XI-5-2 2006-09-06 10:50:37
rpl35 0.5μg/μL GGTCTCTGGCCTTGATCTTTGCCAT 25hpf AB-IX-5-3 AB-VI-4 2006-09-06 10:41:27
rpl35 0.5μg/μL GGTCTCTGGCCTTGATCTTTGCCAT 48hpf AB-IX-5-3 AB-VI-4 2006-10-04 12:36:57
rpl35a 0.5μg/μL GGCATGATGATCCTTTGACCAGGCT 27.5hpf AB-I-6 AB-XI-5-3 2006-09-06 10:49:25
rpl35-mis 0.5μg/μL GGTgTCTcGCCTTcATCTTaGCgAT 25hpf AB-I-6-3 AB-IX-5-1 2006-09-07 10:24:48
rpl36a 0.5μg/μL CATGGTTGCCCTCGCGGCGCAGGAG 28.5hpf AB-XI-5 AB-XI-5-2 2006-09-06 10:49:58
rpl38 0.5μg/μL TTCTTCGATTTTACGTGGCATTGTG 24.5hpf AB-I-6 AB-I-6-1 2006-09-06 10:41:51
rpl38-mis 0.5μg/μL TTgTTaGATTTTAgGTGGgATTcTG 25hpf AB-I-6 AB-I-6-1 2006-09-07 10:59:42
rplp0 5μg/μL CCTGTCTTCCCTGGGCATCTTTGCA 25.5hpf AB-XI-5 AB-XI-5-2 2006-09-06 10:43:33
rplp1 5μg/μL AGGCGAGTTCGGACACAGATGCCAT 25hpf AB-IX-5-1 AB-X-5-1 2006-09-08 13:50:49
rplp2 0.5μg/μL GTAACGCATCTTTGCGGAGAGAAGG 25.5hpf AB-I-6-3 AB-I-6-1 2006-09-06 10:59:57
rplp2 5μg/μL GTAACGCATCTTTGCGGAGAGAAGG 26hpf AB-IX-5-3 AB-I-6-1 2006-09-06 10:48:50
view_list_chart.cgi - v.2006.08.10 mysql